Problème en python [Fermé]

Signaler
-
 Utilisateur anonyme -
bonjour j'ai fais un petit programme qui permet de traduire une séquence d'ARN en protéine mais je n'arrive pas à comprendre ce qui cloche car ça m'affiche qu'il y a erreur

genetic_code = {"UUU":"F","UUC":"F","UUA":"L","UUG":"L","UCU":"S","UCC":"S", 
"UCA":"S","UCG":"S","UAU":"Y","UAC":"Y","UAA":"*","UAG":"*",
"UGU":"C","UGC":"C","UGA":"*","UGG":"W","CUU":"L","CUC":"L",
"CUA":"L","CUG":"L","CCU":"P","CCC":"P","CCA":"P","CCG":"P",
"CAU":"H","CAC":"H","CAA":"Q","CAG":"Q","CGU":"R","CGC":"R",
"CGA":"R","CGG":"R","AUU":"I","AUC":"I","AUA":"I","AUG":"M",
"ACU":"T","ACC":"T","ACA":"T","ACG":"T","AAU":"N","AAC":"N",
"AAA":"K","AAG":"K","AGU":"S","AGC":"S","AGA":"R","AGG":"R",
"GUU":"V","GUC":"V","GUA":"V","GUG":"V","GCU":"A","GCC":"A",
"GCA":"A","GCG":"A","GAU":"D","GAC":"D","GAA":"E","GAG":"E",
"GGU":"G","GGC":"G","GGA":"G","GGG":"G"}
def traduction(Arn , genetic_code):
    proteine = "" 
    for i in range(0, len(Arn), 3): 
        codon = Arn[i : i + 3] 
        acide_amine = genetic_code[codon] 
        proteine = proteine + acide_amine
        return proteine
    traduction ("AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA",genetic_code)


EDIT : Ajout des balises de code (la coloration syntaxique).
Explications disponibles ici : ICI

Merci d'y penser dans tes prochains messages.

1 réponse


Salut,

Moi non plus, je ne comprend pas car avec ton exemple ça me renvoie : 'MAMAPRTEINSTRING*'.

Voici le code que j'ai tapé :

genetic_code = {"UUU":"F","UUC":"F","UUA":"L","UUG":"L","UCU":"S","UCC":"S", 
"UCA":"S","UCG":"S","UAU":"Y","UAC":"Y","UAA":"*","UAG":"*", 
"UGU":"C","UGC":"C","UGA":"*","UGG":"W","CUU":"L","CUC":"L", 
"CUA":"L","CUG":"L","CCU":"P","CCC":"P","CCA":"P","CCG":"P", 
"CAU":"H","CAC":"H","CAA":"Q","CAG":"Q","CGU":"R","CGC":"R", 
"CGA":"R","CGG":"R","AUU":"I","AUC":"I","AUA":"I","AUG":"M", 
"ACU":"T","ACC":"T","ACA":"T","ACG":"T","AAU":"N","AAC":"N", 
"AAA":"K","AAG":"K","AGU":"S","AGC":"S","AGA":"R","AGG":"R", 
"GUU":"V","GUC":"V","GUA":"V","GUG":"V","GCU":"A","GCC":"A", 
"GCA":"A","GCG":"A","GAU":"D","GAC":"D","GAA":"E","GAG":"E", 
"GGU":"G","GGC":"G","GGA":"G","GGG":"G"}
def traduction(Arn , genetic_code):
	proteine = "" 
	for i in range(0, len(Arn), 3): 
		codon = Arn[i : i + 3] 
		acide_amine = genetic_code[codon] 
		proteine = proteine + acide_amine 
	return proteine
traduction (
"AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA",
genetic_code)


1
Merci

Quelques mots de remerciements seront grandement appréciés. Ajouter un commentaire

CCM 65492 internautes nous ont dit merci ce mois-ci

ouiii c'est ce que je voulais, c'est la séquence en acide aminé qu'il fallait traduire
dite moi s'ils vous plait
où l'avez vous exécuter ?
Messages postés
532
Date d'inscription
mercredi 9 mars 2016
Statut
Membre
Dernière intervention
8 mars 2018
93
Au hasard, avec python ?
Utilisateur anonyme
Edite ton message initial et copie colle ton code entre les balises de code python (bouton <> puis python)